View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_93 (Length: 227)
Name: NF18982_low_93
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_93 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 47899814 - 47900039
Alignment:
| Q |
1 |
tgctgtttaaaaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaagaatcataattaatcatgaaagtataaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47899814 |
tgctgtttaacaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaataatcataattaatcatgaaagtataaa |
47899913 |
T |
|
| Q |
101 |
gcattacaaagaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaacgcaaccttcc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47899914 |
gcattacaa-gaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaacgcaaccttcc |
47900012 |
T |
|
| Q |
201 |
ataactgaacatgcttaaccatgaatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47900013 |
ataactgaacatgcttaaccatgaatt |
47900039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University