View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_94 (Length: 226)
Name: NF18982_low_94
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_94 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 45 - 210
Target Start/End: Complemental strand, 26746134 - 26745967
Alignment:
| Q |
45 |
aaggaagttacccctgtttttgttcacatgcctttttgattaccataccatgtgt--atatatatatgatgacagtgaataacaaaacaatccagcaata |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26746134 |
aaggaagttacccctgtttttgttcacatgcctttttgattaccataccatgtgtgtatatatatatgatgacagtgaataacaaaacaatccagcaata |
26746035 |
T |
 |
| Q |
143 |
acatatcatgattcgaatcattcaatcaccaatcttctttacaattttcatcttgctcttccattttc |
210 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26746034 |
acatatcatgattctaatgattcattcaccaatcttctttacaattttcattttgctcttccattttc |
26745967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University