View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_97 (Length: 219)
Name: NF18982_low_97
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_97 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 34099232 - 34099029
Alignment:
| Q |
1 |
aagtaatacaaaaattagaaaaatcaaaactatagaacaaacacatagccggcgatagtgaaactcgccggtgaaatgaacattccggcgaacgtttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34099232 |
aagtaatacaaaaattagaaaaatcaaaactatagaacaaacacattgccggcgatagtgaaactcgccggtgaaatgaacattccggcgaacgtttctt |
34099133 |
T |
 |
| Q |
101 |
ctttttccattaacaatgcacgtcttgccgatcatcgccgccacgtgttccacgagatgatactgtagtgtagtgtagttttacgaagattttcagaaac |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34099132 |
ctttttctattaacaatgcacgtcttgccgatcatcgccgccacgtgttccacgagatgatactgtagtgtagtgtagttttacgaagattttcagaaac |
34099033 |
T |
 |
| Q |
201 |
tttt |
204 |
Q |
| |
|
|||| |
|
|
| T |
34099032 |
tttt |
34099029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University