View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18983_high_2 (Length: 392)
Name: NF18983_high_2
Description: NF18983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18983_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 22 - 376
Target Start/End: Original strand, 24834000 - 24834357
Alignment:
| Q |
22 |
aggcaaattaatgctaaatatgggag---ggtgggggaagtttatgcagcttaaaaaagggatatgggggatataatctgggttatagaagtttaaggag |
118 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24834000 |
aggcaaattattgctaaatatgggagcagggtgggggaagtttatgttgcttaaaaaagggatatgggggatataatctgggttatagaagtttaaggag |
24834099 |
T |
|
| Q |
119 |
gggaataatgtggaggaggttggaagtaggatgggggatgtgtggtttgatgggagaaagttcaaggttaatggagcacagtttggaagggatgagtaga |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
24834100 |
gtgaataatgtggaggaggttggaagtaggatgggggatgtgtggtttgatgggataaagttcaaggttaatagagcacggtttggaagggatgagtaga |
24834199 |
T |
|
| Q |
219 |
tgcagaataaaagcaagctgatggagaaaagaggcgttgatacgtcaacaaagctggtgcagaaatgtcattcataatagtggttgcaactgccaagatc |
318 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24834200 |
tgcaaaataaaagcaagctgatggagaaaagaggcgttgatacgtcaacaaagctggtgcagaaatgtcattcataatagtggttgcgactgccaagatc |
24834299 |
T |
|
| Q |
319 |
ttggtagtagaggagtccatgttggcactttaggtggtggtttgcaagagggtgttga |
376 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24834300 |
ttggtggtagaggagtccatgttggcactttaggtggtggtttgcaagagcgtgttga |
24834357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University