View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18984_high_5 (Length: 252)
Name: NF18984_high_5
Description: NF18984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18984_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 236
Target Start/End: Complemental strand, 3016843 - 3016618
Alignment:
| Q |
11 |
gagcacagacacttcaaattgaacgtgtatcttgtgtacaacaacagacaagtatcaatgtcggatactgacattttagattgaaaaacgtgtcgcttgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016843 |
gagcacagacacttcaaattgaacgtgtatcttgtgtacaacaacagacaagtatcaatgtcggatactgacattttagattgaaaaacgtgtcgcttgt |
3016744 |
T |
 |
| Q |
111 |
ccaacaaccgacaagtatccatgtctgacaccgacacattgatttcattggactactttagctttatcaaattattactagtgttgacgtatcaatgtca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3016743 |
ccaacaaccgacaagtatccatgtctgacaccgacacattgatttcattggactactttagctttatcaaattattactagtgttgacgtatcagtgtca |
3016644 |
T |
 |
| Q |
211 |
gtgatgtgtctgtatccatgtcagtg |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3016643 |
gtgatgtgtctgtatccatgtcagtg |
3016618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 19941743 - 19941702
Alignment:
| Q |
172 |
ctttatcaaattattactagtgttgacgtatcaatgtcagtg |
213 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19941743 |
ctttctcaaattattactagtgttgatgtatcaatgtcagtg |
19941702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University