View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18985_low_8 (Length: 296)
Name: NF18985_low_8
Description: NF18985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18985_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 39281775 - 39281896
Alignment:
| Q |
1 |
taaattaatcatgtgctccttctca---aatgtcagagtttgtcagactgcaagtacgttgatggtagaagcaaatgtattgtttcagcagattttgtgc |
97 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39281775 |
taaattaatcatctgctccttctcagtaaatgtcagagtttgtcagactgcaagtacgttgatggcagaagcaaatgtattgtttcagcagattttgtgc |
39281874 |
T |
|
| Q |
98 |
tgctgagaatcaattgagttca |
119 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39281875 |
tgctgagaatcaattgagttca |
39281896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 186 - 279
Target Start/End: Original strand, 39281963 - 39282060
Alignment:
| Q |
186 |
ccattgtggggtatggtgtttggtaaaatgcctacgagaaaaatctggtgtt----atcgcatgttttttggtaagaattagaagacaaatgttttac |
279 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39281963 |
ccattgtgggataaggtgtttggtaaaatgcctacgagaaaaatctggtgtttagcatcacatgttttttggtaagaattagaagacaaatgttttac |
39282060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University