View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18986_high_13 (Length: 273)
Name: NF18986_high_13
Description: NF18986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18986_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 8346690 - 8346798
Alignment:
| Q |
20 |
tagtacatatcatgctcatatcgagcttgtcaagcaactcgattaaa----tttattgttaatttaactgaattgtaaagtgaagaaacctttacagttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8346690 |
tagtacatatcatgctcatatcgagcttgtcaagcaactcgattaaataaatttattgttaatttaactgaattgtaaagtgaagaaacctttacagttt |
8346789 |
T |
 |
| Q |
116 |
ctaagattg |
124 |
Q |
| |
|
||||||||| |
|
|
| T |
8346790 |
ctaagattg |
8346798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 163 - 259
Target Start/End: Original strand, 8346836 - 8346929
Alignment:
| Q |
163 |
ttagtcattgatcttacaaagaacccagtttcacatgtaattagaagcgagcatatatagactcgatttcactttttgagagagcaagtgatcaaag |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8346836 |
ttagtcattgatcttacaaagaacccagtttcacatgt---tagaagcgagcatatatagactcgatttcactttttgagagagcaagtgatcaaag |
8346929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University