View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18986_high_19 (Length: 205)

Name: NF18986_high_19
Description: NF18986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18986_high_19
NF18986_high_19
[»] chr7 (1 HSPs)
chr7 (17-188)||(39927837-39928008)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 39928008 - 39927837
Alignment:
17 caaagggttccatgtcaggttaattgtcccagttgtgaagcaaattttgaaaatgagtggcatttaatctttggatacgcaagacaaaacaagtttgttt 116  Q
    ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39928008 caaagggttccatgtcaggataattgtccccgttgtgaagcaaattttgaaaatgagtggcatttaatctttggatacgcaagacaaaacaagtttgttt 39927909  T
117 gtttgaaaactgattttttgtggcaaacaatacaatggtaaataatgtagatggttttgtcaaattattctt 188  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39927908 gtttgaaaagtgattttttgtggcaaacaatacaatggtaaataatgtagatggttttgtcaaattattctt 39927837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University