View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18986_high_5 (Length: 501)
Name: NF18986_high_5
Description: NF18986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18986_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 417; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 52 - 480
Target Start/End: Original strand, 47894274 - 47894702
Alignment:
| Q |
52 |
ccacgaggtggttttttgagtcttccatcaaactatgaaggggttggtatggagagggtggaatcaggaagagatcttagagccaaaatctatgcgaaat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47894274 |
ccacgaggtggttttttgagtcttccatcaaactatgaaggggttggtatggagagggtggaatcaggaagagatcttagagccaaaatctatgagaaat |
47894373 |
T |
 |
| Q |
152 |
ttggtaggttgaactcaaacgatggtgttgtttcggtccctgtccctgatattggatgggttgcggaacttgttaactgaatctggatggaagagtatga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894374 |
ttggtaggttgaactcaaacgatggtgttgtttcggtccctgtccctgatattggatgggttgcggaacttgttaactgaatctggatggaagagtatga |
47894473 |
T |
 |
| Q |
252 |
ttttactttgtatagttgaatgatgcaaaaagaaataaaacagctctctgtgcattgttgaggagtatggctttttggtgtctctgtatctgttttctta |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
47894474 |
ttttactttgtatagttgaatgatgcaaaaagaaataaaacagctctctgtgcattgttgaggagtatggcattttggtgtctctatatctgttttctta |
47894573 |
T |
 |
| Q |
352 |
attccttttgacatttaggtttcttcttgtattaaggatttgttgaagattgggtggcatttgattttgttcatcagttcattgttttgttttcttccat |
451 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894574 |
attccttttgacatttaggtttcttcttgtattaaggatttgttgaagattgggtggcatttgattttgttcatcagttcattgttttgttttcttccat |
47894673 |
T |
 |
| Q |
452 |
taactttgtattcttgtctccattttctg |
480 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47894674 |
taactttgtattcttgtctccattttctg |
47894702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 47894222 - 47894255
Alignment:
| Q |
18 |
tgatgaatggagtccggtgtctaagatgggttct |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47894222 |
tgatgaatggagtccggtgtctaagatgggttct |
47894255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University