View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18986_low_13 (Length: 282)
Name: NF18986_low_13
Description: NF18986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18986_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 23 - 215
Target Start/End: Complemental strand, 2356786 - 2356591
Alignment:
| Q |
23 |
tgtgtttggttttacttccaaaacagtcgatgtgcatcttataggaaaggaaaatgataagttgataacaccgaatagaagtcataaacannnnnnnatt |
122 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2356786 |
tgtgtttggtttcactttcgaaacagtcgatgtgcatcttataggaaaggaaaatgataagttgataacaccgaatagaagtcataaacatttttttatt |
2356687 |
T |
 |
| Q |
123 |
tgcactaacttataaca---ttttatgcgataatttgcgtagtttatagctcatgattcataatttaacctatgtaatcgtaattgaaaaaattaa |
215 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2356686 |
tgcactaacttgtaacatttttttatacgataatttacgtagtttatagctcacgattcataatttaacctatgtaatcgtagttgaaaaaattaa |
2356591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University