View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18986_low_20 (Length: 205)
Name: NF18986_low_20
Description: NF18986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18986_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 39928008 - 39927837
Alignment:
| Q |
17 |
caaagggttccatgtcaggttaattgtcccagttgtgaagcaaattttgaaaatgagtggcatttaatctttggatacgcaagacaaaacaagtttgttt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39928008 |
caaagggttccatgtcaggataattgtccccgttgtgaagcaaattttgaaaatgagtggcatttaatctttggatacgcaagacaaaacaagtttgttt |
39927909 |
T |
 |
| Q |
117 |
gtttgaaaactgattttttgtggcaaacaatacaatggtaaataatgtagatggttttgtcaaattattctt |
188 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39927908 |
gtttgaaaagtgattttttgtggcaaacaatacaatggtaaataatgtagatggttttgtcaaattattctt |
39927837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University