View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18987_high_6 (Length: 415)
Name: NF18987_high_6
Description: NF18987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18987_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 19 - 351
Target Start/End: Original strand, 24200780 - 24201109
Alignment:
| Q |
19 |
caaggtccaaactctcttcgtcgtcaagtatgctataaggacgacgttggccttcaaaacgatctaactgaagcctgcaaacaggacaggttttactggt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24200780 |
caaggtccaaactctcttcgtcgtcaagtatgctataaggacgacattggccttcaaaacgatctaactgaagcctgcaaacaggacaggttttactggt |
24200879 |
T |
|
| Q |
119 |
gttaacccaacgaagaatgcattcgaacttgtatgtatgcttgcagggtaactggcatgcttggtcaccaagtttaaactcctccatgcaaataggacag |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24200880 |
gttaagccaacgaagaatgcattcgaacttgtatgtatgcttgcagggtaactggcatgcttggtcaccaagtttaaactcctccatgcaaataggacag |
24200979 |
T |
|
| Q |
219 |
tgagagacatcatcttttaaatgcaactttgagattttcaccatatgacttcgaaggaactgactatgatcgtcgtcatcatcaggctggccatgcgtgg |
318 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| || ||| |||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
24200980 |
tgagagacatcatcttttaaatgcagctttgagattttcacaatgtgatttcgaaggaactgactatgatcgtcg---tcatcaggccggccatgcgtgg |
24201076 |
T |
|
| Q |
319 |
tcaaagaaaggaaaggatcaaagtagtcccatg |
351 |
Q |
| |
|
|||||||| |||||| || |||| ||||||||| |
|
|
| T |
24201077 |
tcaaagaagggaaagtattaaagaagtcccatg |
24201109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University