View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18987_high_7 (Length: 280)
Name: NF18987_high_7
Description: NF18987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18987_high_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 31254032 - 31253737
Alignment:
| Q |
1 |
tccatagagtcttgccgattcctttgtggtcctttgaaaattgggtgtcttttggagcaaccttc---------catgatcattgttgaatttgattcca |
91 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31254032 |
tccatagagtcttgccgattcctttatggtcctttgaaaattgggtgtcttttggagcaaccttcttcggcttccatgatcattgttgaatttgattcca |
31253933 |
T |
 |
| Q |
92 |
caggaataagtttgtatcttctatgctaagcaatcatagtgaggtattctctctcagccatatggacaacaagcaacttttattggtcagtcc------- |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31253932 |
caggaataagtttgtatcttctatgctaagcaatcatagtgaggtat----tctcagccatatggacaacaagcaacttttattggtcagtcctgttgaa |
31253837 |
T |
 |
| Q |
185 |
----tgttgatttcatcaatagtccaaactttgagtgtcatcagaaaatggggactaatttctaagatttacaagtttttcaagttcgtgtcaatatcaa |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31253836 |
ttcttgttgatttcatcaatagtccaaactttgaatgtcatcagaaaatggggactaatttctaagatttacaagtttttcaagttcgtgtcaatatcaa |
31253737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University