View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18987_high_9 (Length: 204)

Name: NF18987_high_9
Description: NF18987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18987_high_9
NF18987_high_9
[»] chr1 (1 HSPs)
chr1 (7-187)||(29144999-29145179)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 7 - 187
Target Start/End: Complemental strand, 29145179 - 29144999
Alignment:
7 gagaaaagaaaactaacctggcttgaggaactcgatttcgatgcagggttggcttcattttgaccaacaacttgatcctttttatcatcaaccttagtta 106  Q
    ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29145179 gagaaaagaaaactaacctggcttgaggagcccgatttcgatgcagggttggcttcattttgaccaacaacttgatcctttttatcatcaaccttagtta 29145080  T
107 ataccaagctagaatcataatctgaagagccatctaaaaaagttgtgtcgctgagcaaagatctagctgaaccatgtggag 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
29145079 ataccaagctagaatcataatctgaagagccatctaaaaaagttgtgtcgctgagcaaagatctagttgaaccatgtggag 29144999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University