View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18987_low_10 (Length: 207)
Name: NF18987_low_10
Description: NF18987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18987_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 182
Target Start/End: Original strand, 14464571 - 14464735
Alignment:
| Q |
19 |
ggctgtcaagaataataaa-cataaattttaaagtctctgcttcgtgaaagnnnnnnngaaacgaaggtgaaagaggtttttgagtcatgtgaagttgtt |
117 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14464571 |
ggctgtcaagaataaaaaaacataaatttgaaagtctctgcttcgtgaaagaaaaaaagaaacgaaggtgaaagaggtttttgagtcttgtgaagttgtt |
14464670 |
T |
|
| Q |
118 |
gaatgaagtggaaatgggacatgagagcattgaaacggagaccgagtgtgcggagattgaagatt |
182 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14464671 |
gaatgaagtggaaatgggacctgagagcattgaaacggagaccgagtgtgcggagattgaagatt |
14464735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 89 - 137
Target Start/End: Original strand, 45443998 - 45444046
Alignment:
| Q |
89 |
aagaggtttttgagtcatgtgaagttgttgaatgaagtggaaatgggac |
137 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45443998 |
aagagggttttgagtctggtgaagttgttgaatgaagtggaaatgggac |
45444046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 139 - 172
Target Start/End: Original strand, 45444194 - 45444227
Alignment:
| Q |
139 |
tgagagcattgaaacggagaccgagtgtgcggag |
172 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
45444194 |
tgagagcattgaaacggagactgagtgtgcggag |
45444227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University