View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18987_low_11 (Length: 204)
Name: NF18987_low_11
Description: NF18987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18987_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 7 - 187
Target Start/End: Complemental strand, 29145179 - 29144999
Alignment:
| Q |
7 |
gagaaaagaaaactaacctggcttgaggaactcgatttcgatgcagggttggcttcattttgaccaacaacttgatcctttttatcatcaaccttagtta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145179 |
gagaaaagaaaactaacctggcttgaggagcccgatttcgatgcagggttggcttcattttgaccaacaacttgatcctttttatcatcaaccttagtta |
29145080 |
T |
 |
| Q |
107 |
ataccaagctagaatcataatctgaagagccatctaaaaaagttgtgtcgctgagcaaagatctagctgaaccatgtggag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29145079 |
ataccaagctagaatcataatctgaagagccatctaaaaaagttgtgtcgctgagcaaagatctagttgaaccatgtggag |
29144999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University