View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18987_low_9 (Length: 214)
Name: NF18987_low_9
Description: NF18987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18987_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 24201200 - 24201400
Alignment:
| Q |
1 |
ctagtggtaataatgatgatgatggtggnnnnnnnggcggtggtggcggtggaggtagagaactccagttgatccgaggttctggatttggtggttgtga |
100 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24201200 |
ctagtggtaataatgatgatggtggtggaaaaaaaggcggtggtggcggtggaggtagagaactccagttgatccgaggttctggatttggtggttgtga |
24201299 |
T |
|
| Q |
101 |
tggcagtagcgacggttgtgaagaccgctgattgatttgaggttcggagtttacaggttgaaattgtagcggtggtactgatcgtactgatagtcgtgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24201300 |
tggcagtagcgacggttgtgaagaccgctgattgattcgaggttctgagtttacaggttgaaattgtagcggtggtactgatcgtactgatagtcgtgat |
24201399 |
T |
|
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
24201400 |
g |
24201400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University