View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1898_high_27 (Length: 225)
Name: NF1898_high_27
Description: NF1898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1898_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 40463003 - 40462809
Alignment:
| Q |
1 |
taaagattaggctacacccattaattgaaaagtgattagatggagaaggagtttatagt-gataaactagtagacagctaatgaatttatagtagataaa |
99 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40463003 |
taaagattagggtacacccattaattgaaaagtgattagatggagaaggagtttatagtagataaactagtagacagctaatgaatttatagtagataaa |
40462904 |
T |
 |
| Q |
100 |
gtataaataaatttatagtttatattatcaaattgaacttatagttgatacgatcaaattgaatttagttgacatataaacacattattaaacaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40462903 |
gtataaataaatttatagtttatattatcaaattgaacttatagttgatacgatcaaattgaatttagttgacatataaacacattattaaacaa |
40462809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University