View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1898_low_31 (Length: 206)
Name: NF1898_low_31
Description: NF1898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1898_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 28931437 - 28931608
Alignment:
| Q |
20 |
gtatacaggaaaaccctttaattgagttatgagactagatatttaaatcaccttcctaaaacaaatgaaggaatagatctaacctttcatgctcagacat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28931437 |
gtatacaggaaaaccctttaattgagttatgagactagatatttaaatcaccttcctaaaacaaatgaaggaatagatctaacctttcatgctcagacat |
28931536 |
T |
 |
| Q |
120 |
gaaaaagcttgctctgttgnnnnnnncttaggttttctttcctctcacttatagattttattgtctcctatg |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28931537 |
gaaaaagcttgctctgttgtttttttcttaggttttctttcctctcacttatagattttattgtctgctatg |
28931608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 136
Target Start/End: Complemental strand, 35122722 - 35122609
Alignment:
| Q |
21 |
tatacaggaaaaccctttaattgagttatgagactagatatttaaatcaccttcctaaaacaaatgaaggaatagatctaacctttcatgctcagacatg |
120 |
Q |
| |
|
|||||||| |||||||||| |||||||| |||||| ||||||||||||| | | | |||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
35122722 |
tatacagggaaacccttta-ttgagttacgagactctgtatttaaatcaccgttccgagacaaatgagagaatagatccaacctttcatgctaggacat- |
35122625 |
T |
 |
| Q |
121 |
aaaaagcttgctctgt |
136 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
35122624 |
aaaaagcttgttctgt |
35122609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University