View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18990_low_2 (Length: 246)
Name: NF18990_low_2
Description: NF18990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18990_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 3 - 188
Target Start/End: Original strand, 23177324 - 23177506
Alignment:
| Q |
3 |
aactatgaactgggatttttcaccagaaacaacagagagaactccaccaagtactatgtgggtatatggtttaaaaaggtaccaaaggacaagattattt |
102 |
Q |
| |
|
||||| ||||||||||||||||| || | |||||||||||| |||||||||||||| ||||||||||| ||||||||| |||| ||||||||| ||| |
|
|
| T |
23177324 |
aactacgaactgggatttttcactcga---atcagagagaactcgaccaagtactatgtaggtatatggttcaaaaaggtagcaaatgacaagattgttt |
23177420 |
T |
|
| Q |
103 |
gggttgccaacagagattacgcatttcaaacatcctcggcgttacttaccattcatcctgatggtaatattgtgatcatagatgga |
188 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||| ||||||||| | | ||||||||||||||| |||||||||||| |
|
|
| T |
23177421 |
gggttgccaacagagacaacgcatttcaaacatcctcggtgtttcttaccattgaccatgatggtaatattgtaatcatagatgga |
23177506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 3 - 188
Target Start/End: Original strand, 23186459 - 23186644
Alignment:
| Q |
3 |
aactatgaactgggatttttcaccagaaacaacagagagaactccaccaagtactat---gtgggtatatggtttaaaaaggtaccaaaggacaagatta |
99 |
Q |
| |
|
||||| ||||| ||||||||||| ||||| | |||||||||| | ||||||||| || ||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
23186459 |
aactacgaacttggatttttcactagaaata---gagagaactcgatcaagtactactacgtaggtatatggttcaaaaaggtagcaaatgacaagattg |
23186555 |
T |
|
| Q |
100 |
tttgggttgccaacagagattacgcatttcaaacatcctcggcgttacttaccattcatcctgatggtaatattgtgatcatagatgga |
188 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||| ||||||||||| ||||||||| ||||| |||||||||||| |
|
|
| T |
23186556 |
tttgggttgccaacagagattacgaacctcaaacatcctcggcgtttcttaccattcacgatgatggtaacattgtcatcatagatgga |
23186644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 21182426 - 21182387
Alignment:
| Q |
202 |
tcgtgaccaacgttccaaacaacaactataatacctatgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21182426 |
tcgtgaccaacgttccaaacaacaactataatacctatgc |
21182387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University