View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18991_low_18 (Length: 233)
Name: NF18991_low_18
Description: NF18991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18991_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 40 - 215
Target Start/End: Complemental strand, 22162868 - 22162693
Alignment:
| Q |
40 |
gtttgcataggtagatggagtaaacttgtgcagcaagttatgttgtctgttatcttgcatattatttggaaaatctcgatagaaagaaacagtagatatt |
139 |
Q |
| |
|
||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22162868 |
gtttgtataagtagatgtagtaaacttgtgcagcaagttatgttgtctgttatcttgcatattatttggaaaatctggatagaaagaaacagtagatatt |
22162769 |
T |
 |
| Q |
140 |
tttcagtatcagcacactaccatttctagcatgataaatggtataatagttgaagttcatcttagatttgctttgt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22162768 |
tttcaagatcagcacactaccatttctagcatgataaatggtataatagttgaagttcatcttagatttgctttgt |
22162693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 22163529 - 22163488
Alignment:
| Q |
1 |
cagcaacttgatatttcaaattggcatagtcttatcatcgtt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22163529 |
cagcaacttgatatttcaaattggcatagtcttatcatcgtt |
22163488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University