View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18991_low_8 (Length: 282)
Name: NF18991_low_8
Description: NF18991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18991_low_8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 194285 - 194549
Alignment:
| Q |
18 |
atccacctgtctcatgtttgattaataatcctttcattctatgggtttctgatgttgctcaatccctttccctcccttctgctttgctttggattcaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194285 |
atccacctgtctcatgtttgattaacaatcctttcattccatgggtttctgatgttgctcaatccctttccctcccttctgctttgctttggattcaatc |
194384 |
T |
|
| Q |
118 |
atgtgcttccttctcttcttactatcattactatcataaattagtttctttcccttctcaatcccatccccatattcatgttcagctgccatgtatgcct |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194385 |
atgtgcttccttctctacttactatcattactatcataaattagtttctttcccttctcaatcccatccccatattcatgttcagctgccatgtatgcct |
194484 |
T |
|
| Q |
218 |
ctgttgaattatgatcaagtccctagcttcttgtatcccaccactccctatccatttcttagaag |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194485 |
ctgttgaattatgatcaagtccctagcttcttgtatcccaccactccctatccatttcttagaag |
194549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University