View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18991_low_9 (Length: 271)
Name: NF18991_low_9
Description: NF18991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18991_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 66 - 259
Target Start/End: Original strand, 34526016 - 34526209
Alignment:
| Q |
66 |
ggatatgggtagtgttatagtgtattaaggttcatatcattaccgcaaaacttcaatttcaacctatgacaaaatcctactactacatcttactttaaca |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34526016 |
ggatatgggtagtgttatagtgtattaaggttcatatcattaccgcaaaatttcaatttcaacctatgacaaaatcctactgctacatcttactttaaca |
34526115 |
T |
|
| Q |
166 |
aaccagaccatgaaaccaaacaactaagactctgttgagcttatagcttataagatcatgcgacaaaaaagacctgtttgataacattttttct |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34526116 |
aaccagaccatgaaaccaaacaactaacactctgttgagcttatagcttataagatcatgcgacaaaaaagacctgtttgataacattttttct |
34526209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 31677101 - 31677148
Alignment:
| Q |
200 |
ttgagcttatagcttataagatcatgcgacaaaaaagacctgtttgat |
247 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
31677101 |
ttgagcttatagcttataagctaatttgacaaaaaagacctgtttgat |
31677148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University