View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18992_low_11 (Length: 344)
Name: NF18992_low_11
Description: NF18992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18992_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 18 - 127
Target Start/End: Original strand, 9637651 - 9637760
Alignment:
| Q |
18 |
atcggtatacgaccttgtgtgcttctatataaacctaataaaaaattgtgtgatatagatttaacaagatatgatcagtacaagtgtatcaaggagaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9637651 |
atcggtatacgaccttgtgtgcttctatataaacctgataaaaaattgtgtgatatagatttaacaagatatgattagtacaagtgtatcaaggagaata |
9637750 |
T |
|
| Q |
118 |
tgattagtaa |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
9637751 |
tgattagtaa |
9637760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 303 - 344
Target Start/End: Original strand, 43106702 - 43106743
Alignment:
| Q |
303 |
tctctcacttttggaactcaatgttttcattgttcttcttcc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43106702 |
tctctcacttttggaactcaatgttttcattgttcttcttcc |
43106743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 128 - 182
Target Start/End: Original strand, 9637782 - 9637836
Alignment:
| Q |
128 |
ttgaaattagcaacattctaaatttaggatgggatatcactagaactaggttatc |
182 |
Q |
| |
|
||| ||||||||||||||||| |||||||||| |||||| ||||| || |||||| |
|
|
| T |
9637782 |
ttggaattagcaacattctaagtttaggatggaatatcagtagaagtaagttatc |
9637836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University