View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18992_low_13 (Length: 336)
Name: NF18992_low_13
Description: NF18992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18992_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 41 - 218
Target Start/End: Original strand, 46533099 - 46533275
Alignment:
| Q |
41 |
taacaacttttatatataaaaaatatattttgtatgtgttagacataatccttttggcatatgtcagatagacacatgcaatgcaactaaagatttctaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46533099 |
taacaacttttatatataaaaaatatattttgtatgtgttagacataatccttttggcatatgtcagatagacacatgcaatgcaactaaagatttctaa |
46533198 |
T |
 |
| Q |
141 |
aatcttaaggctgaaatgtgttaaagtgacctctataagacatgatttgtggactcaccagccccattcgacattttg |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46533199 |
aatcttaaggttgaaatgtgttaaagtgacctctataagacatgatttgtggactca-cagccccattcgacattttg |
46533275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 217 - 291
Target Start/End: Original strand, 46533317 - 46533391
Alignment:
| Q |
217 |
tggcctggcactctgactaaaacaccgccctccactaacaaaacttcccttaggataatgtaatatgtctctata |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46533317 |
tggcctggcactctgactaaaacaccgccctccactaacaaaacttcccttaggataatgtaatatgtctctata |
46533391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University