View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18992_low_16 (Length: 295)
Name: NF18992_low_16
Description: NF18992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18992_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 46503109 - 46502818
Alignment:
| Q |
1 |
tcttctttttagaggtgagtttagtgggaataaagttggtttatgtgagagaaagagacaaaagaaaaagtatgagataaagcagagagaattgtaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503109 |
tcttctttttagaggtgagtttagtgggaataaagttggtttatgtgagagaaagagacaaaagaaaaagtatgagataaagcagagagaattgtaactt |
46503010 |
T |
 |
| Q |
101 |
ccttacaaagaagtaagaaccaatggaaaacatagggctaaatagtctttttcatccttaaatgttaaat-agtacatacatatattaaaattacaaaat |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46503009 |
ccttacaaagaagcaagaaccaatggaaaacatagggctaaatagtctttttcatccttaaatgttaaataagtacatacatatattaaaattacaaaat |
46502910 |
T |
 |
| Q |
200 |
catatgtaaatttgtctttgnnnnnnnnaagtcatttgaattctcaagtcatgtgtttttagttagttagtttttgttatccctttgcttct |
291 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||| |
|
|
| T |
46502909 |
catatgtaaatttgtctttgttttttttaagtcatttgaattctcaagtcatgtgtttttagttggctagtttttgttatccctttgattct |
46502818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University