View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18992_low_17 (Length: 293)
Name: NF18992_low_17
Description: NF18992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18992_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 31 - 280
Target Start/End: Complemental strand, 8756507 - 8756258
Alignment:
| Q |
31 |
gaacctgtgaataacatagcgatctgctcccatataaaacataatataggttcattggctgctattggtggaagtccaagatactcgccaccgcgatcat |
130 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756507 |
gaaccggtgaataacatagcgatctgctcccatataaaacataatataggttcattggctgctattggtggaagtccaagatactcgccaccgcgatcat |
8756408 |
T |
|
| Q |
131 |
cagcgggggcagatactcgaagaagccatgaaacatcaccaatagagttttctagatgggaggatgttttacggaaggctgcagctggtatgatggtgaa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756407 |
cagcgggggcagatactcgaagaagccatgaaacatcaccaatagagttttctagatgggaggatgttttacggaaggctgcagctggtatgatggtgaa |
8756308 |
T |
|
| Q |
231 |
gacacgtttcatgagaccattagcacgacattttaggactaatgaaagtg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756307 |
gacacgtttcatgagaccattagcacgacattttaggactaatgaaagtg |
8756258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University