View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18992_low_23 (Length: 219)
Name: NF18992_low_23
Description: NF18992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18992_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 35081231 - 35081444
Alignment:
| Q |
1 |
taggaatgatagagaaaaataaaatatgtaaaccactttctcannnnnnn--aggaaatagcaagaattagtctttgtgatcatacctagtttgcatgga |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35081231 |
taggaatgatagagaaaaataaaatatgtaaaccactttctcatttttttttaggaaatagcaagaattagtctttgtgatcatacctagtttgcatcga |
35081330 |
T |
 |
| Q |
99 |
cgttgttgcactacgatatttaataaccggaatttgaatttagaattttctacttattcatcttaagagtgaaactaagaacaataaatgtaaaatatta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||| ||| |
|
|
| T |
35081331 |
cgttgttgcactacgatatttaataaccgaaatttgaatttagaattttctacttattcatcttaagagtgaaactaaaaataataaatttaaaatttta |
35081430 |
T |
 |
| Q |
199 |
cgcagcctatgctt |
212 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35081431 |
cgcagcctatgctt |
35081444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 174
Target Start/End: Original strand, 28258016 - 28258047
Alignment:
| Q |
143 |
attttctacttattcatcttaagagtgaaact |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28258016 |
attttctacttattcatcttaagagtgaaact |
28258047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University