View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18992_low_24 (Length: 218)
Name: NF18992_low_24
Description: NF18992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18992_low_24 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 218
Target Start/End: Complemental strand, 46503549 - 46503335
Alignment:
| Q |
4 |
aaggtggtttgaaagcgtaccgtttgggagaagttgcatgcagagaggtagctcacgtttgaaagcatcgattttgagacgttcttcttctaagcgagaa |
103 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503549 |
aaggtggtttgaaagtgtaccgtttgtgagaagttgcatgcagagaggaagctcacgtttgaaagcatcgattttgagacgttcttcttctaagcgagaa |
46503450 |
T |
 |
| Q |
104 |
acaaattcttcgagtttgtagctttgatcactttgttctccaaatgatttcagtaacatggagtagctatgtggcttgcaatccaagcctagttcagatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503449 |
acaaattcttcgagtttgtagctttgatcactttgttctccaaatgatttcagtaacatggagtagctatgtggcttgcaatccaagcctagttcagatg |
46503350 |
T |
 |
| Q |
204 |
atgaagccattcttt |
218 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46503349 |
atgaagccattcttt |
46503335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 75
Target Start/End: Original strand, 34055224 - 34055260
Alignment:
| Q |
39 |
gcatgcagagaggtagctcacgtttgaaagcatcgat |
75 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
34055224 |
gcatggagagaggtagttcacgtttgaaagcatcgat |
34055260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University