View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_118 (Length: 241)
Name: NF18993_high_118
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_118 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 122 - 231
Target Start/End: Complemental strand, 35887213 - 35887104
Alignment:
| Q |
122 |
gactgtcttgtgtaatttcaggtgtctggcactttgatcagatgctgctcaacgaagcggctgcagcttgatgattttattttctcccacttcagtcatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35887213 |
gactgtcttgtgtaatttcaggtgtctggcactttgatcagatgctgctcaacgaagcggctgcagcttgatgattttattttctcccacttcagtcatt |
35887114 |
T |
 |
| Q |
222 |
tgtacctctg |
231 |
Q |
| |
|
|||| ||||| |
|
|
| T |
35887113 |
tgtatctctg |
35887104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 35887334 - 35887273
Alignment:
| Q |
1 |
tcagctaagaagaggtggtaaaggacatggtgaggatttctatttctactccatgcatctta |
62 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35887334 |
tcagctaagaagagttggcaaaggacatggtgaggatttctatttctactccatgcatctta |
35887273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University