View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18993_high_118 (Length: 241)

Name: NF18993_high_118
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18993_high_118
NF18993_high_118
[»] chr5 (2 HSPs)
chr5 (122-231)||(35887104-35887213)
chr5 (1-62)||(35887273-35887334)


Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 122 - 231
Target Start/End: Complemental strand, 35887213 - 35887104
Alignment:
122 gactgtcttgtgtaatttcaggtgtctggcactttgatcagatgctgctcaacgaagcggctgcagcttgatgattttattttctcccacttcagtcatt 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35887213 gactgtcttgtgtaatttcaggtgtctggcactttgatcagatgctgctcaacgaagcggctgcagcttgatgattttattttctcccacttcagtcatt 35887114  T
222 tgtacctctg 231  Q
    |||| |||||    
35887113 tgtatctctg 35887104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 35887334 - 35887273
Alignment:
1 tcagctaagaagaggtggtaaaggacatggtgaggatttctatttctactccatgcatctta 62  Q
    |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
35887334 tcagctaagaagagttggcaaaggacatggtgaggatttctatttctactccatgcatctta 35887273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University