View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_123 (Length: 238)
Name: NF18993_high_123
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_123 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 50 - 149
Target Start/End: Complemental strand, 5475315 - 5475218
Alignment:
| Q |
50 |
taaaataaatgtagtcataaactgtttactattttaagaattctccttgacacacacttcttgttttttctgcttgtttttgttccttcttattaaaaaa |
149 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5475315 |
taaaataaatgtaatcataaactgttcactattttaagaattctccttgac--acacttcttgttttttctgcttgtttttgttgcttcttattaaaaaa |
5475218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 145 - 207
Target Start/End: Complemental strand, 5474618 - 5474556
Alignment:
| Q |
145 |
aaaaattggatatgcctgctgcctgagatgtgacattggtacattaatttcttgtgcaaactt |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5474618 |
aaaaattggatatgcctgctgcctaagatgtgacattggtacattaatttcttgtgcaaactt |
5474556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 5475861 - 5475804
Alignment:
| Q |
1 |
tctaaattaaatacatgaacttagcaggctcaaaatcatggtaatgctgtaaaataaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
5475861 |
tctaaattaaatacatgaacttagcaggcccaaaattatggtaatgctgtaaaataaa |
5475804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 88
Target Start/End: Complemental strand, 5483587 - 5483523
Alignment:
| Q |
24 |
gcaggctcaaaatcatggtaatgctgtaaaataaatgtagtcataaactgtttactattttaaga |
88 |
Q |
| |
|
|||| |||||| ||| || |||||||||||||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
5483587 |
gcagcctcaaagtcacggcaatgctgtaaaataaatgaagtcataaattgtttattattttaaga |
5483523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University