View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_130 (Length: 234)
Name: NF18993_high_130
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_130 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 41215550 - 41215775
Alignment:
| Q |
1 |
caaacacctggcgtgcgttcagttgaaacaaattcaataatttgagatagaagtgataacataccatgaagcgccataattgataacagcctgcaaacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41215550 |
caaacacctggcgtgcgttcagttgaaacaaattcaataatttgagatagaagtgataacataccatgaagcgccataattgataacagcctgcaaaaaa |
41215649 |
T |
|
| Q |
101 |
ttttgaaacacgagagttaaatacatatctacgagaaatcgt-----atnnnnnnnntgtggtgagaatggttgcttacgggagttttggaggatttgat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41215650 |
ttttgaaacacgagagttaaatacatatctacgagaaatcgtaaaaaaaataaaaattgtggtgagaatggttgcttacgggagttttggaggatttgat |
41215749 |
T |
|
| Q |
196 |
gtttgtgatgatttgagtgaaattat |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41215750 |
gtttgtgatgatttgagtgaaattat |
41215775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 159 - 210
Target Start/End: Original strand, 39525753 - 39525803
Alignment:
| Q |
159 |
gagaatggttgcttacgggagttttggaggatttgatgtttgtgatgatttg |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39525753 |
gagaatggttgtttacgggagttttggagga-ttgatgtttgtgatgatttg |
39525803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University