View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_140 (Length: 226)
Name: NF18993_high_140
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_140 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 192
Target Start/End: Complemental strand, 42467326 - 42467149
Alignment:
| Q |
15 |
aaatacaaagaaagaaccaaggaaaatgacaaccacacaatatagagttatttgggattaaggaagtgaagaacgagtagtttcgaggaagatgagctta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42467326 |
aaatacaaagaaagaaccaaggaaaatgacaaccacacaatatagagttatttgggattaaggaagtgaagaacgagtagtttcgaggaagatgagctta |
42467227 |
T |
 |
| Q |
115 |
aatgtgacatagcatgcatttgtatatatacactaaaaaatattgtgtaagggacttgattgggtgagaaacttgtac |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42467226 |
aatgtgacatagcatgcatttgtatatatacactaaaaaatattgtgtaagggacttgattgggtgagaaacttgtac |
42467149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University