View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_144 (Length: 219)
Name: NF18993_high_144
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_144 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 47025596 - 47025781
Alignment:
| Q |
14 |
caaaggaaaaatagttatcttcaagta-ggtttagtcttgatagagtcaaagttgtctcgtcctatatatcaatgcttaaaagagtggcaatgttataag |
112 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47025596 |
caaagggaaaatagttatcttcaagtaaggtttagtcttgatagagtcaaagttgtctcgtcctatatatcaatgcttaaaagagtggcaatattataag |
47025695 |
T |
 |
| Q |
113 |
gtcatgggactagcacatctaacaaagatttccactcttttaagcagatcaaacactttattagaacttttgtttgtcttatacga |
198 |
Q |
| |
|
||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47025696 |
gtcctgggactagcccatctaacaaagattgccactcttttaagcagatcaaacactttattagaactcttgtttgtcttatacga |
47025781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University