View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_147 (Length: 215)
Name: NF18993_high_147
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_147 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 49446130 - 49446314
Alignment:
| Q |
15 |
tgagatgaaggattttgaggcagggaagtctaatggaagtaaagcccttcacagagaaacgctgaaatttgagaacaacaagagtcttgcagctgagaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446130 |
tgagatgaaggattttgaggcagggaagtctaatggaagtaaagcccttcacagagaaacgctgaaatttgagaacaacaagagtcttgcagctgagaat |
49446229 |
T |
 |
| Q |
115 |
gctaataggcaatttaggaccaccaccaaacatagtatccacaaggagatcaatggtctcaactccgctttgtacaacatggttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446230 |
gctaataggcaatttaggaccaccaccaaacatagtatccacaaggagatcaatggtctcaactccgctttgtacaacatggttg |
49446314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 129
Target Start/End: Original strand, 17642084 - 17642192
Alignment:
| Q |
21 |
gaaggattttgaggcagggaagtctaatggaagtaaagcccttcacagagaaacgctgaaatttgagaacaacaagagtcttgcagctgagaatgctaat |
120 |
Q |
| |
|
|||||||||||||| || | ||||||| | ||| ||| |||||||||| ||| | | ||| | |||||||||||||||| ||||| | |||||||||| |
|
|
| T |
17642084 |
gaaggattttgagggagaggagtctaaagaaagaaaaccccttcacagcgaacccataaaactcgagaacaacaagagtcctgcaggttagaatgctaac |
17642183 |
T |
 |
| Q |
121 |
aggcaattt |
129 |
Q |
| |
|
| ||||||| |
|
|
| T |
17642184 |
aagcaattt |
17642192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University