View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_30 (Length: 432)
Name: NF18993_high_30
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 11 - 178
Target Start/End: Original strand, 51231404 - 51231571
Alignment:
| Q |
11 |
ttattctgtggggtatctttatttaggtcccttccatatggctgtatatgtacgcagtgctctctcttttggggtgtttttctttatttgccttgtcatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51231404 |
ttattctgtggggtatctttatttaggtcccttccatatggctgtatatgtacacagtgctctctcttttggggtgtttttctttatttgccttgtcatt |
51231503 |
T |
 |
| Q |
111 |
atttttggatggagtctacgttatagtgatatactctatatttccatttaatatattctccttgcctt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
51231504 |
atttttggatggagtctacgttatagtgatatactctatatttcctttttatatattctcctagcctt |
51231571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 257 - 414
Target Start/End: Original strand, 51231649 - 51231798
Alignment:
| Q |
257 |
gatgaactatatcagtagaaattctgtcaaaaacaaacgaattatgattgtatgatatatatgatannnnnnnnnnattacagtgagggccaaaacacgt |
356 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||| |
|
|
| T |
51231649 |
gatgaactatatcagtataaattctgtcaaaaacaaacgaattatgattgtatgatatatatttt--------tttattacagtgagggccaaaacccgt |
51231740 |
T |
 |
| Q |
357 |
atgtatgatatgattttagtgttccaaatttttacaaatagaagtcacctacgattag |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51231741 |
atgtatgatatgattttagtgttccaaatttttacaaatagaagtcacctacgattag |
51231798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University