View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_54 (Length: 358)
Name: NF18993_high_54
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 35 - 223
Target Start/End: Complemental strand, 42983320 - 42983132
Alignment:
| Q |
35 |
acaaacgcttctccaaaccccacaaacacaaccaaaaaaccaaactttctgataattctccttcacaacccgacccaattagcccgacccatttatcaaa |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983320 |
acaaacgcttctccaaaccccacaaacacaaccaaaaaaccaaactttctgataattctccttcacaacccgacccaattagcccgacccatttatcaaa |
42983221 |
T |
 |
| Q |
135 |
atcgattctttttgaagttctcccctctgattccgctaaatgggataccttgttcgatgacccggattcagttttggaagttccatcgg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983220 |
atcgattctttttgaagttctcccctctgattccgctaaatgggataccttgttcgatgacccggattcagttttggaagttccatcgg |
42983132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 299 - 344
Target Start/End: Complemental strand, 42983056 - 42983011
Alignment:
| Q |
299 |
cgggttttgattcgggtgtgaagcttgagtctgattgcatgtatcc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42983056 |
cgggttttgattcgggtgtgaagcttgaatctgattgcatgtatcc |
42983011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University