View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_60 (Length: 341)
Name: NF18993_high_60
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 251 - 326
Target Start/End: Complemental strand, 763404 - 763329
Alignment:
| Q |
251 |
gcagcgactgagagcaacaggatgatcgaacgtagtaagtaggaaagggaacgacaacaacgtggtgggttgtttc |
326 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
763404 |
gcagcgacagagagcaacaggatgatcgaacgtagtaagcaggaaagggaacgacaacaacatggtgggttgtttc |
763329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University