View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_64 (Length: 333)
Name: NF18993_high_64
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_64 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 333
Target Start/End: Complemental strand, 40440653 - 40440335
Alignment:
| Q |
16 |
gtttggatgatttatagggacaagctaagcttgcagcttgttgtattgaagtggggttgaacatgcgcacatgcatatgtgtactatgttccaaaccaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40440653 |
gtttggatgatttatagggacaagctaagcttgcagcttgttgtatcgaagtgtggctgaacatacgcacatgcatatgtgtgctatgttccaaaccaac |
40440554 |
T |
 |
| Q |
116 |
aag-aaaatgataagggaatgttaagaagtattgacccttgggttaaaacgagttcgaatttttcagcgtactcgtgcatcttcccaccttgttg--gac |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||| |
|
|
| T |
40440553 |
aagaaaaatgataagggaatgttaagaagtattgacccttgggttaaaacgagttcgaatttttcatcgtactcttgcatcttcccaccttgttgttgac |
40440454 |
T |
 |
| Q |
213 |
gtgaatcaaagtagccagggggtcttcatcagcgtatttttgccatggaggagtatttgtatcttgccagcatgtagtttaagtgtcattgaagggcaag |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || | |||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40440453 |
gtgaatcaaagtagcca-ggggtcttcatcagcatactcttgccatggaggagta-tcgtatcttgcccgcatgtagtttaagtgtcattgaagggcaag |
40440356 |
T |
 |
| Q |
313 |
accatcaaagtgaatcgatgc |
333 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40440355 |
accatcaaagtgaatcgatgc |
40440335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University