View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_high_66 (Length: 328)
Name: NF18993_high_66
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_high_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 4 - 315
Target Start/End: Complemental strand, 31730598 - 31730285
Alignment:
| Q |
4 |
aatatattttattgtgaatttggattcagacaaagatatgaatttggaactatatgtatcagaaattcatattcaaagtaaagcacaatatttgatgctt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31730598 |
aatatattttattgtgaatttggattcagacaaagatatgaatttggaactatatgtatcagaaattcatattcaaagtaaagcacaatatttgatgctt |
31730499 |
T |
 |
| Q |
104 |
ctcttaatatagtattgttttatgttttgcaatataggaggatgcttttcatacactaagtcaagcacgtttagaccccacatgacctttctttctaagg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31730498 |
ctcttaatatagtattgttttatgttttgcaatataggaggatgcttttcatacactaagtcaagcacgtttagaccccacatgacctttctttctaagg |
31730399 |
T |
 |
| Q |
204 |
ttgtggaaaatttaataccacttttcaccaatcattgttgactc--tttcgtaaactatcttgctaagatatgattgtcataattaattaagaatctact |
301 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31730398 |
ttgtggaaaatttactaccacttttcaccaatcattgttgactctttttcataaactatcttgctaagatatgattgtcataattaattaagaatctact |
31730299 |
T |
 |
| Q |
302 |
ccatgatgtaactg |
315 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31730298 |
ccatgatgtaactg |
31730285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University