View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_116 (Length: 243)
Name: NF18993_low_116
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_116 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 83 - 228
Target Start/End: Complemental strand, 551601 - 551456
Alignment:
| Q |
83 |
ttttatctatgcatgtaacaaagacgatacccaatttttctagtgtagcctatttttgctccaattcaatattacccttgcatatatctttaccttttaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
551601 |
ttttatctatgcatgtaacaaagacgatacccaatttttctagtgtagcctatttttgctccaattcaatattacccttgcataaatctttaccttttga |
551502 |
T |
|
| Q |
183 |
atatgttagttttacttcacaataacacgtgtcctacttataattt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
551501 |
atatgttagttttacttcacaataacacgtgtcctacttataattt |
551456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 551637 - 551722
Alignment:
| Q |
1 |
aaatacaaaattgggtataacctttatcgttggtataaatgttctctcaattatagtgttataaatcatacacaattctatttttt |
86 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
551637 |
aaataaaaaattgggtataacctttatcattggtataaatgttctctcaatgatagtcttataaatcatacacaattctatttttt |
551722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University