View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_118 (Length: 242)
Name: NF18993_low_118
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_118 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 35153914 - 35153688
Alignment:
| Q |
1 |
tagttttaaattaccatgcttagtaattaacttaatctgttttttaatgtgcatataatttat--gttttaatcaacttcattctattgcagaatttgta |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35153914 |
tagttttaaattaccatgcttagtaattaacttaatctgttttttaatgtgcatataatttatatgttttaatcaacttcattctattgcagaatttgta |
35153815 |
T |
|
| Q |
99 |
ttgatgtacttgaggtttccaacggtgttttgaaaatgtgataaacatctttgcaaagagttggtgatcttcatttaatgtgtcatgcttcttcctggca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35153814 |
ttgatgtacttgaggtttccaacggtgttttgaaaatgtgataaacatctttgcaaagagttggtgatcttcatttaatgtgtcatgcttcttcctggca |
35153715 |
T |
|
| Q |
199 |
agtgtagtttattttgatgcttagttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35153714 |
agtgtagtttattttgatgcttagttt |
35153688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 44 - 191
Target Start/End: Complemental strand, 27133591 - 27133440
Alignment:
| Q |
44 |
ttaatgtgcatataatttatgttttaatcaacttc----attctattgcagaatttgtattgatgtacttgaggtttccaacggtgttttgaaaatgtga |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||| | ||| | |||||||||| |
|
|
| T |
27133591 |
ttaatgtgcatataatttatgttttaatcaatttctttcattctattgcagaatttatattgatgtacttgagaatcgtgttggtctcaagaaaatgtga |
27133492 |
T |
|
| Q |
140 |
taaacatctttgcaaagagttggtgatcttcatttaatgtgtcatgcttctt |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
27133491 |
taaacatctttgcaaagaggtggtgatcttcatttgatgtatcatgcttctt |
27133440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University