View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18993_low_130 (Length: 237)

Name: NF18993_low_130
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18993_low_130
NF18993_low_130
[»] chr8 (1 HSPs)
chr8 (21-193)||(32916681-32916853)
[»] chr4 (1 HSPs)
chr4 (22-54)||(6560964-6560996)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 21 - 193
Target Start/End: Complemental strand, 32916853 - 32916681
Alignment:
21 cacattagcatctctcccttaaatgtgagactctctccatcagtgatatatagacatagctaagatcagatggatgcacaactcgctnnnnnnngatagg 120  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||    
32916853 cacattagcatctctcccttaaatgtgagactctctgcatcagtgatatatagacatagctaagatcagatggatgcacaactcgctaaaaaaagatagg 32916754  T
121 atggtaatgatttcatgtaacggggttttcgttcctcccttcatgaaaagagagaaaggtaattaaataaagg 193  Q
    |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||    
32916753 atggtaatgatttcatgtaatggggtttttgttcctcccttcatgaaaagagagaaaggtaattaaataaagg 32916681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 54
Target Start/End: Complemental strand, 6560996 - 6560964
Alignment:
22 acattagcatctctcccttaaatgtgagactct 54  Q
    ||||||||||||||||||||| |||||||||||    
6560996 acattagcatctctcccttaactgtgagactct 6560964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University