View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_138 (Length: 232)
Name: NF18993_low_138
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_138 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 8446470 - 8446244
Alignment:
| Q |
1 |
gacatggctccttttctttatttgtatgatgaacattttgattcgagtgatctaggatgctaaattgttaagctttgattctaaattttgattatcttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446470 |
gacatggctccttttctttatttgtatgatgaacattttgattcgagtgatttaggatgctaaattgttaagctttgattctaaattttgattatcttga |
8446371 |
T |
 |
| Q |
101 |
aaaatgtcacttggcctctagtgatctaggaagctaaattatggcacactagctattcctttggcataaaaactaatataatataatctaaagtggattt |
200 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8446370 |
aaaatgtcac-----ctccagtgatctaggaagctaaattatggcacactagctattcctttggcataaaaactaatataatctaatctaaagtggattt |
8446276 |
T |
 |
| Q |
201 |
ctaggggtacgaacataagagactaaagtatc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8446275 |
ctaggggtacgaacataagagactaaagtatc |
8446244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University