View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_139 (Length: 230)
Name: NF18993_low_139
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_139 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 214
Target Start/End: Original strand, 3242855 - 3243050
Alignment:
| Q |
19 |
ttatatgcattatcgaatataagacagacaagcaattgcctccttcacccattgcagatggagggttttaggtgtaaatagttaacctagaattatagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3242855 |
ttatatgcattatcgaatataagacagacaagcaattgcctccttcacccattgcagatggagggttttaggtgtaaatagttaacctagaattatagag |
3242954 |
T |
 |
| Q |
119 |
gtgctgcctggaaaacgaaaaaagaacaaatttggtttataaacctatttaaagagaaccacatcaattaaacgaaactacaaatattaatttctt |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3242955 |
gtgctgcctggaaaacaaaaaaagaacaaatttggtttataaacctatttaaagagaaccacatcaattaaacgaaactacaaatattaatttctt |
3243050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University