View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_142 (Length: 228)
Name: NF18993_low_142
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_142 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 33271141 - 33271349
Alignment:
| Q |
17 |
agtttttgaacaagctaagtattggaaataatccactaaagaaagaaacaacatgttcatggcaagttcttttcttggatgaagaaaagagcttgttatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33271141 |
agtttttgaacaagctaagtattggaaataatccactaaagaaagaaacaacatgttcatggcaagttcttttcttggatgaagaaaagagcttgttatt |
33271240 |
T |
|
| Q |
117 |
cttaagtggagtaatgagttttttccatagaggaggtggatttggagaatttagcatccactgtgtcctatctatttgatgagtatcttcaagatgatga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33271241 |
cttaagtggagtaatgagttttttccatagaggaggtggatttggagaatttagcatccactgtgtcctatctatttgatgagtatcttcaagatgaaga |
33271340 |
T |
|
| Q |
217 |
tgtccatct |
225 |
Q |
| |
|
| ||||||| |
|
|
| T |
33271341 |
tttccatct |
33271349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University