View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_154 (Length: 208)
Name: NF18993_low_154
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_154 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 24 - 185
Target Start/End: Original strand, 27744315 - 27744476
Alignment:
| Q |
24 |
gaagaagaagcttatcagtgatcctcgatttgtaggaatgcacacagaccctcgttttcgagaggctcgaaaggatgaaacaaaagtggcaattgactct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27744315 |
gaagaagaagcttatcagtgatcctcgatttgtaggaatgcacacagaccctcgttttcgagaggctcgaaaggatgaaacaaaagtggcaattgactct |
27744414 |
T |
|
| Q |
124 |
cgcttcaagcacatgttcaatgacaattcttttttctcttattctgcaccaatcgacaagag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27744415 |
cgcttcaagcacatgttcaatgacaattcttttttctcttattctgcaccaatcgacaagag |
27744476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 84
Target Start/End: Original strand, 49513261 - 49513321
Alignment:
| Q |
24 |
gaagaagaagcttatcagtgatcctcgatttgtaggaatgcacacagaccctcgttttcga |
84 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
49513261 |
gaagaagaagcttatcaatgatcctcggtttgtaggagtgctcacagaccctctttttcga |
49513321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University