View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18993_low_156 (Length: 203)

Name: NF18993_low_156
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18993_low_156
NF18993_low_156
[»] chr3 (1 HSPs)
chr3 (1-191)||(6057518-6057708)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 6057518 - 6057708
Alignment:
1 atggaccttgaattgttacatcagtaagcatgtccatggaaggccaggacaggccagtaagtagtttctcgcaattcatgatgcgaatcgatctcaactt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
6057518 atggaccttgaattgttacatcagtaagcatgtccatggaaggccaggacagaccagtaagtagtttctcgcaattcatgatgcgaatcgatctcaactt 6057617  T
101 aggtggcataccactttcgggaaatgattcaatttctggacagttttctagtcggaaatattctaactttggaagaagaatgttcatctca 191  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6057618 aggtggcataccactttcggggaatgattcaatttctggacagttttctagtcggaaatattctaactttggaagaagaatgttcatctca 6057708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University