View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_157 (Length: 203)
Name: NF18993_low_157
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_157 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 26 - 185
Target Start/End: Complemental strand, 19223461 - 19223303
Alignment:
| Q |
26 |
gacaaaccttgtggggtttgaatttctagcatgaggttctaagaaagctattttctttcacataattaatctgatgcaacccatttggacttttgtatag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19223461 |
gacaaaccttgtggggtttgaatttctagcatgaggttctaagacagctattttctttcacataattaatctgatgcaacccatttggacttttgtatag |
19223362 |
T |
 |
| Q |
126 |
ctgaagaaaagaacaattttattccaaggaagattcaaatgcatgatttgcaagtgggaa |
185 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19223361 |
ctgaagacaagaacaattttattccaaggaagattcaaatgcatga-ttgcaagtgggaa |
19223303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University