View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_158 (Length: 203)
Name: NF18993_low_158
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_158 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 28437632 - 28437451
Alignment:
| Q |
14 |
tttgaacttgaaactccaccaatggaagaaaattggttatagtaaaatggttttgaagagaaaggtaagg------------gtaaagaaccaagatgaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28437632 |
tttgaacttgaaactccaccaatggaagagaattggttatagtaaaatggttttgaagagaaaggtaaggataaaggtaagggtaaagaaccaagatgaa |
28437533 |
T |
|
| Q |
102 |
aatcaagagaaggtgaagtagagtacttattaatggcttgagatggtgtagatgagtgtttgagtttttgtttctttctaca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28437532 |
aatcaagagaaggtgaagtagagtacttattaatggcttgagatggtgtagatgagtgtttgagtttttgtttctttctaca |
28437451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University